No questions found
What are found in both mitochondria and typical prokaryotic cells?
Which statements about light microscopes are correct?
1. To calculate the magnification of a light microscope, the eyepiece lens and objective lens magnifications are added together.
2. As the magnification increases, the resolution decreases.
3. The resolution of a light microscope is limited by the wavelength of light.
4. The scale on a stage micrometer is resolved more clearly than an eyepiece graticule.
Which comparison of a phloem companion cell with a B-lymphocyte is correct?
Ribosomes exist as separate subunits that bind together during protein synthesis.
What do these subunits consist of?
Which structures in plant cells have a double membrane?
What is the diameter of a typical prokaryote, such as \textit{Streptococcus}?
Which molecule is \(\alpha\)-glucose?
The diagram shows the three-dimensional structure of collagen. Which labelled part represents a molecule of collagen?
Which type of bond does not hold together the tertiary structure of a protein?
Which properties of water are a result of only cohesion?
1. The water has a high surface tension.
2. Water moves up xylem vessels.
3. Water is an excellent solvent.
The protein glutenin gives bread dough its elasticity. The diagram represents a polypeptide of glutenin. What describes the structure of glutenin?
A student carried out four tests for biological molecules. The observations are shown in the table.
[Table_1]
Which molecules are present in the solution?
Some inhibitors of enzyme reactions bind to the enzyme-substrate complex. Which statements about this type of inhibition are correct?
1. The active site changes shape.
2. The inhibitor is non-competitive.
3. The initial rate of reaction is reduced.
4. The maximum rate of reaction ($V_{max}$) stays the same.
The enzyme DNA polymerase is used in DNA replication. This enzyme was extracted from bacteria living in natural hot water springs where the water temperature is between 85°C and 95°C. Which graph would represent the relationship between temperature and the rate of DNA replication when catalysed by the enzyme from these bacteria?
What supports the view that a membrane protein is involved in active transport?
The graph shows the effect of increasing the concentration of glucose in a solution on the rate of entry of glucose into a cell.
What are not causes of the plateau at X?
Which set of factors will produce the least fluid cell surface membrane?
[Table_1]
The diagrams show chromosomes at different stages of mitosis:
[Image_1 showing W, X, Y, Z]
Which shows the correct order of the cell cycle?
Which diagrams show the correct relationships?
Which row correctly describes adenine?
Which row shows two pairs of nucleotides formed when mRNA is translated?
Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the $\beta$-globin polypeptide of haemoglobin.
The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) $\beta$-globin alleles.
HbA: CTGACTCCTGAGGAGAAGTCT
HbS: CTGACTCCTGTGGAGAAGTCT
How will the mutation in the HbS allele result in the production of an altered version of the $\beta$-globin polypeptide?
Which force holds water molecules on the surface of cell walls?
The statements are about the properties of water.
1 requires a lot of heat to evaporate
2 holds a lot of heat
3 is able to form hydrogen bonds with other water molecules
4 is able to form hydrogen bonds with other polar molecules
Which properties are important for translocation in phloem?
Which changes to the water potential and the volume of liquid in the phloem occur when amino acids are moved into a phloem sieve tube at a source?
Which feature of transport in xylem depends on the use of energy?
What is correct about the transport of carbon dioxide by blood?
1. The enzyme carbonic anhydrase catalyses the formation of carbonic acid in red blood cells.
2. Carbon dioxide diffuses from respiring cells to red blood cells and reacts with water.
3. Carbonic acid dissociates forming hydrogen ions that combine with haemoglobin to form carbaminohaemoglobin.
The graph shows the effect of different partial pressures of carbon dioxide (CO₂) on the oxygen dissociation curve for haemoglobin.
What is the change in percentage oxygen saturation of haemoglobin at a partial pressure of oxygen of 6 kPa as the partial pressure of carbon dioxide changes from 1.0 kPa to 1.5 kPa?
Which structures transport deoxygenated blood?
Which effect could be due to a reduced concentration of carbonic anhydrase?
Which row identifies the effects on the body of nicotine in tobacco smoke?
[Table_1]
Lung cancer and chronic obstructive pulmonary disease (COPD) share a number of common symptoms.
Which symptom is typical of lung cancer and not COPD?
A person breathes in small particles from a very dusty environment. What effect will this have on B-lymphocytes and goblet cells? [Table_1]
The diagram shows properties of diseases. What shows the properties that are common to both tuberculosis (TB) and measles?
Strains of \textit{Mycobacterium} have been found that are:
• multiple drug-resistant (MDR) – resistant to the drugs most commonly used to control tuberculosis (TB)
• extensively drug-resistant (XDR) – resistant to the drugs most commonly used to control TB and to some of the drugs less commonly used to control TB
• totally drug-resistant (TDR) – resistant to all known drugs used to control TB.
Comparisons of some of these strains of \textit{Mycobacterium} found differences in the thickness of their cell walls, as shown in the table.
[Table_1]
What conclusions may be drawn from this information?
What describes natural passive immunity?
What happens when people are injected with dead bacteria?
The diagram represents part of the nitrogen cycle.
Which process is carried out by nitrifying bacteria?
A primary consumer, X, is lost from a community due to a lethal viral infection.
After a time, the size of the populations of some of the organisms shown in the food web changed.
Which population of organisms increased?
The table shows the results of a field study of four species in a food chain in an area of woodland.
[Table_1]
Which is the correct pyramid of energy from these data?