All Questions from this Paper: AS & A Level Biology - 9700 Paper 1 2015 Summer Zone 3
Theory
MCQ
01.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

What are found in both mitochondria and typical prokaryotic cells?

02.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

Which statements about light microscopes are correct?
1. To calculate the magnification of a light microscope, the eyepiece lens and objective lens magnifications are added together.
2. As the magnification increases, the resolution decreases.
3. The resolution of a light microscope is limited by the wavelength of light.
4. The scale on a stage micrometer is resolved more clearly than an eyepiece graticule.

03.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

Which comparison of a phloem companion cell with a B-lymphocyte is correct?

04.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

Ribosomes exist as separate subunits that bind together during protein synthesis.
What do these subunits consist of?

05.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

Which structures in plant cells have a double membrane?

06.
MCQ 1 Marks
CH1 - CELL STRUCTURE, Cell Structure

What is the diameter of a typical prokaryote, such as \textit{Streptococcus}?

07.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

Which molecule is \(\alpha\)-glucose?

08.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

The diagram shows the three-dimensional structure of collagen. Which labelled part represents a molecule of collagen?

09.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

Which type of bond does not hold together the tertiary structure of a protein?

10.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

Which properties of water are a result of only cohesion?

1. The water has a high surface tension.
2. Water moves up xylem vessels.
3. Water is an excellent solvent.

11.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

The protein glutenin gives bread dough its elasticity. The diagram represents a polypeptide of glutenin. What describes the structure of glutenin?

12.
MCQ 1 Marks
CH2 - BIOLOGICAL MOLECULES, Biological Molecules

A student carried out four tests for biological molecules. The observations are shown in the table.

[Table_1]

Which molecules are present in the solution?

13.
MCQ 1 Marks
CH3 - ENZYMES, Enzymes

Some inhibitors of enzyme reactions bind to the enzyme-substrate complex. Which statements about this type of inhibition are correct?
1. The active site changes shape.
2. The inhibitor is non-competitive.
3. The initial rate of reaction is reduced.
4. The maximum rate of reaction ($V_{max}$) stays the same.

14.
MCQ 1 Marks
CH3 - ENZYMES, Enzymes

The enzyme DNA polymerase is used in DNA replication. This enzyme was extracted from bacteria living in natural hot water springs where the water temperature is between 85°C and 95°C. Which graph would represent the relationship between temperature and the rate of DNA replication when catalysed by the enzyme from these bacteria?

15.
MCQ 1 Marks
CH4 - CELL MEMBRANES AND TRANSPORT, Cell Membranes And Transport

What supports the view that a membrane protein is involved in active transport?

16.
MCQ 1 Marks
CH4 - CELL MEMBRANES AND TRANSPORT, Cell Membranes And Transport

The graph shows the effect of increasing the concentration of glucose in a solution on the rate of entry of glucose into a cell.

What are not causes of the plateau at X?

17.
MCQ 1 Marks
CH4 - CELL MEMBRANES AND TRANSPORT, Cell Membranes And Transport

Which set of factors will produce the least fluid cell surface membrane?
[Table_1]

18.
MCQ 1 Marks
CH5 - THE MITOTIC CELL CYCLE, The Mitotic Cell Cycle

The diagrams show chromosomes at different stages of mitosis:
[Image_1 showing W, X, Y, Z]
Which shows the correct order of the cell cycle?

19.
MCQ 1 Marks
CH5 - THE MITOTIC CELL CYCLE, The Mitotic Cell Cycle

Which diagrams show the correct relationships?

20.
MCQ 1 Marks
CH6 - NUCLEIC ACIDS AND PROTEIN SYNTHESIS, Nucleic Acids And Protein Synthesis

Which row correctly describes adenine?


21.
MCQ 1 Marks
CH6 - NUCLEIC ACIDS AND PROTEIN SYNTHESIS, Nucleic Acids And Protein Synthesis

Which row shows two pairs of nucleotides formed when mRNA is translated?

22.
MCQ 1 Marks
CH6 - NUCLEIC ACIDS AND PROTEIN SYNTHESIS, Gene Mutations: Types and Effects on Polypeptide Produced, Nucleic Acids And Protein Synthesis

Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the $\beta$-globin polypeptide of haemoglobin.


The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) $\beta$-globin alleles.



HbA: CTGACTCCTGAGGAGAAGTCT


HbS: CTGACTCCTGTGGAGAAGTCT



How will the mutation in the HbS allele result in the production of an altered version of the $\beta$-globin polypeptide?

23.
MCQ 1 Marks
CH7 - TRANSPORT IN PLANTS, Transport in Plants

Which force holds water molecules on the surface of cell walls?

24.
MCQ 1 Marks
CH7 - TRANSPORT IN PLANTS, Transport in Plants

The statements are about the properties of water.


1 requires a lot of heat to evaporate


2 holds a lot of heat


3 is able to form hydrogen bonds with other water molecules


4 is able to form hydrogen bonds with other polar molecules


Which properties are important for translocation in phloem?

25.
MCQ 1 Marks
CH7 - TRANSPORT IN PLANTS, Transport in Plants

Which changes to the water potential and the volume of liquid in the phloem occur when amino acids are moved into a phloem sieve tube at a source?


26.
MCQ 1 Marks
CH1 - CELL STRUCTURE

Which feature of transport in xylem depends on the use of energy?

27.
MCQ 1 Marks
CH8 - TRANSPORT IN MAMMALS, Transport In Mammals

What is correct about the transport of carbon dioxide by blood?
1. The enzyme carbonic anhydrase catalyses the formation of carbonic acid in red blood cells.
2. Carbon dioxide diffuses from respiring cells to red blood cells and reacts with water.
3. Carbonic acid dissociates forming hydrogen ions that combine with haemoglobin to form carbaminohaemoglobin.

28.
MCQ 1 Marks
CH8 - TRANSPORT IN MAMMALS, Transport In Mammals

The graph shows the effect of different partial pressures of carbon dioxide (CO₂) on the oxygen dissociation curve for haemoglobin.
What is the change in percentage oxygen saturation of haemoglobin at a partial pressure of oxygen of 6 kPa as the partial pressure of carbon dioxide changes from 1.0 kPa to 1.5 kPa?

29.
MCQ 1 Marks
CH8 - TRANSPORT IN MAMMALS, Structure of Mammalian Heart, Transport In Mammals

Which structures transport deoxygenated blood? 

 

30.
MCQ 1 Marks
CH8 - TRANSPORT IN MAMMALS, Transport In Mammals

Which effect could be due to a reduced concentration of carbonic anhydrase?

31.
MCQ 1 Marks
CH9 - GAS EXCHANGE AND SMOKING, Gas Exchange And Smoking

Which row identifies the effects on the body of nicotine in tobacco smoke?
[Table_1]

32.
MCQ 1 Marks
CH9 - GAS EXCHANGE AND SMOKING, Gas Exchange And Smoking

Lung cancer and chronic obstructive pulmonary disease (COPD) share a number of common symptoms.
Which symptom is typical of lung cancer and not COPD?

33.
MCQ 1 Marks
CH9 - GAS EXCHANGE AND SMOKING, Gas Exchange And Smoking

A person breathes in small particles from a very dusty environment. What effect will this have on B-lymphocytes and goblet cells? [Table_1]

34.
MCQ 1 Marks
CH10 - INFECTIOUS DISEASE, Infectious Disease

The diagram shows properties of diseases. What shows the properties that are common to both tuberculosis (TB) and measles?

35.
MCQ 1 Marks
CH10 - INFECTIOUS DISEASE, Infectious Disease

Strains of \textit{Mycobacterium} have been found that are:
• multiple drug-resistant (MDR) – resistant to the drugs most commonly used to control tuberculosis (TB)
• extensively drug-resistant (XDR) – resistant to the drugs most commonly used to control TB and to some of the drugs less commonly used to control TB
• totally drug-resistant (TDR) – resistant to all known drugs used to control TB.
Comparisons of some of these strains of \textit{Mycobacterium} found differences in the thickness of their cell walls, as shown in the table.
[Table_1]
What conclusions may be drawn from this information?

36.
MCQ 1 Marks
CH11 - IMMUNITY, Immunity

What describes natural passive immunity?

37.
MCQ 1 Marks
CH11 - IMMUNITY, Immunity

What happens when people are injected with dead bacteria?

38.
MCQ 1 Marks
CH1 - CELL STRUCTURE

The diagram represents part of the nitrogen cycle.
Which process is carried out by nitrifying bacteria?

39.
MCQ 1 Marks
CH1 - CELL STRUCTURE

A primary consumer, X, is lost from a community due to a lethal viral infection.
After a time, the size of the populations of some of the organisms shown in the food web changed.
Which population of organisms increased?

40.
MCQ 1 Marks
CH1 - CELL STRUCTURE

The table shows the results of a field study of four species in a food chain in an area of woodland.

[Table_1]

Which is the correct pyramid of energy from these data?